Русский

chr17:41243571 T>TGCCTCATTTGTTTGGAAGAACCAATCAA

Основные

  • Ген
  • BRCA1
  • Транскрипт
  • NM_007294.3
  • кДНК
  • c.3976_3977insTTGATTGGTTCTTCCAAACAAATGAGGC
  • Белок
  • p.H1326fs
  • Функция
  • frameshift ins
  • Локализация
  • exon
  • hg19
  • chr17:41243571 T>TGCCTCATTTGTTTGGAAGAACCAATCAA
  • dbSNP

Синонимы

  • Транскрипт
  • кДНК
  • Белок
  • NM_007298.3
  • c.788-550_788-523dupTTGATTGGTTCTTCCAAACAAATGAGGC
  • NM_007299.3
  • c.788-550_788-523dupTTGATTGGTTCTTCCAAACAAATGAGGC
  • NM_007297.3
  • c.3835_3836insTTGATTGGTTCTTCCAAACAAATGAGGC
  • p.H1279fs
  • NM_007300.3
  • c.3976_3977insTTGATTGGTTCTTCCAAACAAATGAGGC
  • p.H1326fs
  • NR_027676.1
  • n.4085_4112dupTTGATTGGTTCTTCCAAACAAATGAGGC

Частота в gnomAD

  • Genome
  • Exome
  • MAX
  • AFR
  • AMR
  • ASJ
  • EAS
  • FIN
  • NFE
  • SAS